You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ctpB [2019-07-12 09:36:27]
carboxy-terminal processing serine protease, cleaves
SpoIVFA, this results in processing of pro-
SigKMolecular weight
52.63 kDa
Function
control of
SigK activation
Product
carboxy-terminal processing serine protease, cleaves
SpoIVFAGenomic Context
Categories containing this gene/protein
Gene
Coordinates
3,622,356 3,623,798
The protein
Protein family
Peptidase s41a family (together with CtpA) (according to Uniprot)PDZ protease PubMed Paralogous protein(s)
Domains
signal peptide (aa 1 - 23) (according to Uniprot)PDZ domain (aa 92 - 182) (according to Uniprot)S41 peptidase domain (by similarity to CtpA) PubMedpeptidoglycan binding domain (C-terminal) (by similarity to CtpA) PubMed Effectors of protein activity
substrate binding of CtpB induces opening of the PDZ gate and protease activation PubMedCtpB acts in concert with a second signaling protease, SpoIVB PubMed Structure
4C2C PubMedforms a ring-like scaffold with two narrow tunnels for substrate binding PubMed Localization
intracellular space between the mother cell and the forespore PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A074 (yvjB::erm), available at the NBRP B. subtilis, Japan1S129 ( ctpB::tet), PubMed, available at BGSCBKE35240 (ctpB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA, downstream forward: _UP4_TAAAGGAGATGGTATTTCATBKK35240 (ctpB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA, downstream forward: _UP4_TAAAGGAGATGGTATTTCAT References
Loading